Prev. | Human A to Z list > K > 

RIKEN DNA Bank Human Resource - KIAA0141

Gene ID (NCBI) 9812
Gene Symbol KIAA0141
Protein Name KIAA0141
Synonyms DELE
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX004865 IRAK012C17 pCMV-SPORT6 BC011269 NM_014773 Full
HGX004866 IRAK012C18 pCMV-SPORT6 BC010452 NM_014773 Full
HGY088248 IRAL020K08 pOTB7 BC007855 NM_014773
HGY091550 IRAL028O14 pOTB7 BC011926 NM_014773 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098847 M01C047B23 pDONR221 MGC13-C12 BC007855 ENST00000194118  
HGE098895 M01C047D23 pDONR221 MGC13-C12 BC007855 ENST00000194118  
HGE098943 M01C047F23 pDONR221 MGC13-C12 BC007855 ENST00000194118  
HGE098991 M01C047H23 pDONR221 MGC13-C12 BC007855 ENST00000194118  
HGE099039 M01C047J23 pDONR221 MGC13-C12 BC007855 ENST00000194118  
HGE099087 M01C047L23 pDONR221 MGC13-C12 BC007855 ENST00000194118  
HGE099135 M01C047N23 pDONR221 MGC13-C12 BC007855 ENST00000194118  
HGE099183 M01C047P23 pDONR221 MGC13-C12 BC007855 ENST00000194118  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR391254 RBd78C06 pGCAP10 NM_014773.2  
TGACTCGGCCACTCGGGGCATCGCGGCGGCCTTTCTAGCCGCTGTCCCAAGGGTTGGTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl