Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02416

HP ID(1) HP02416
Gene ID(2) 5714
Gene Symbol finder PSMD8
Protein Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
RefSeq NM_002812.4
Length of RefSeq (bp) 1556
Chromosome 19q13.2
Reference DDBJ accession
UniGene Hs.78466

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe23B12 pKA1U5 GGGTCTGCTTGCCGCATCACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTT
ARe62G04 pKA1U5 GGGTCTGCTTGCCGCATCACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTT
ARe71C10 pKA1U5 GGGTCTGCTTGCCGCATCACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTT
ARiS122H09 pGCAP10 GATCACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTTCTCGAGCTCCGGGC
ARiS194K05 pGCAP10 GGCATCACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTTCTCGAGCTCCGG
RBb12D10 pKA1U5 GGCATCACGCAAGATGGCGGCCGCGGCGGNTGAACGGGGCGGCAGGCTTCTCGAGCTCCG
RBb24A10 pGCAP1 GACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTTCTCGAGCTCCGGGCCCG
RBb47B04 pGCAP1 GGTCTGCTTGCCGCATCACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTTC
RBb65C09 pGCAP1 GAGGCGGTCTGCTTGCCGCATCACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAG
RBdS075O17 pGCAP10 GACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTTCTCGAGCTCCGGGCCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl