Prev. |  KEGG KO K03031 > 

RIKEN DNA Bank Human Resource - PSMD8

Gene ID NCBI Gene 5714 |  KEGG hsa:5714
Gene Symbol PSMD8
Protein Name proteasome 26S subunit, non-ATPase 8
Synonyms HEL-S-91n|HIP6|HYPF|Nin1p|Rpn12|S14|p31
Ortholog resources KEGG ortholog (KEGG orthology K03031) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056117 IRAK140E21 pCMV-SPORT6 BC065006 NM_002812 Full
HGY083443 IRAL008K03 pOTB7 BC001164 NM_002812 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049236 ARe23B12 pKA1U5 NM_002812.4  
GGGTCTGCTTGCCGCATCACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTT
HKR064948 ARe62G04 pKA1U5 NM_002812.4  
GGGTCTGCTTGCCGCATCACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTT
HKR068458 ARe71C10 pKA1U5 NM_002812.4  
GGGTCTGCTTGCCGCATCACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTT
HKR248977 ARiS122H09 pGCAP10 NM_002812.4  
GATCACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTTCTCGAGCTCCGGGC
HKR277845 ARiS194K05 pGCAP10 NM_002812.4  
GGCATCACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTTCTCGAGCTCCGG
HKR324882 RBb12D10 pKA1U5 NM_002812.4  
GGCATCACGCAAGATGGCGGCCGCGGCGGNTGAACGGGGCGGCAGGCTTCTCGAGCTCCG
HKR329610 RBb24A10 pGCAP1 NM_002812.4  
GACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTTCTCGAGCTCCGGGCCCG
HKR338828 RBb47B04 pGCAP1 NM_002812.4  
GGTCTGCTTGCCGCATCACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTTC
HKR346057 RBb65C09 pGCAP1 NM_002812.4  
GAGGCGGTCTGCTTGCCGCATCACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAG
HKR430353 RBdS075O17 pGCAP10 NM_002812.4  
GACGCAAGATGGCGGCCGCGGCGGTGAACGGGGCGGCAGGCTTCTCGAGCTCCGGGCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl