Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02379

HP ID(1) HP02379
Gene ID(2) 115024
Gene Symbol finder NT5C3L
Protein Name 5'-nucleotidase, cytosolic III-like
RefSeq NM_052935.3
Length of RefSeq (bp) 1553
Chromosome 17q21.2
Reference DDBJ accession
UniGene Hs.237536

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi11E01 pGCAP10 GGCCTCGAACGGGATGGCAGAGGAGGTGAGGAGGGAGGAAGCGTCCGGAGTGGGGCGGGC
ARiS198A06 pGCAP10 GGtgtccCGCGAGCCGCCgaccAGGCCTCGAacGGGAtGGCAGAGGAGGtGAGGAGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl