Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NT5C3B

Gene ID (NCBI) 115024
Gene Symbol NT5C3B
Protein Name 5'-nucleotidase, cytosolic IIIB
Synonyms NT5C3L
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008853 IRAK022C05 pCMV-SPORT6 BC016971 NM_052935 Full
HGX011250 IRAK028C02 pCMV-SPORT6 BC013742 NM_052935 Full
HGY067319 IRAK168E23 pBluescriptR BC067788 NM_052935 Full
HGY092295 IRAL030M07 pOTB7 BC014132 NM_052935

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE100427 M01C051B03 pDONR221 MGC15-C02 BC014132 ENST00000269534
HGE100475 M01C051D03 pDONR221 MGC15-C02 BC014132 ENST00000269534
HGE100523 M01C051F03 pDONR221 MGC15-C02 BC014132 ENST00000269534
HGE100571 M01C051H03 pDONR221 MGC15-C02 BC014132 ENST00000269534
HGE100619 M01C051J03 pDONR221 MGC15-C02 BC014132 ENST00000269534
HGE100667 M01C051L03 pDONR221 MGC15-C02 BC014132 ENST00000269534
HGE100715 M01C051N03 pDONR221 MGC15-C02 BC014132 ENST00000269534
HGE100763 M01C051P03 pDONR221 MGC15-C02 BC014132 ENST00000269534

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR164497 ARi11E01 pGCAP10 NM_052935.3
GGCCTCGAACGGGATGGCAGAGGAGGTGAGGAGGGAGGAAGCGTCCGGAGTGGGGCGGGC
HKR279206 ARiS198A06 pGCAP10 NM_052935.3
GGtgtccCGCGAGCCGCCgaccAGGCCTCGAacGGGAtGGCAGAGGAGGtGAGGAGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl