Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02378

HP ID(1) HP02378
Gene ID(2) 4716
Gene Symbol finder NDUFB10
Protein Name NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
RefSeq NM_004548.2
Length of RefSeq (bp) 741
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.513266

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe18C10 pKA1U5 GCGCAGACGCAGCCGCCCTCGGCGTCCTCTGTAGCGGGCGACCTAGGCCGCGGGACCCGG
ARe46E09 pKA1U5 TGACCCGGACGGAGGTAGAGGCCAGGGCAGCGCGTCCGGGAGCGGAGTCCGCGCCCGCCG
RBd14H09 pGCAP10 GAGGCCGCGGGACCCGGACGGAGGTAGAGGCCAGGGCAGCGCGTCCGGAGCGGAGTCCGC
RBd36C09 pGCAP10 GAGCGGGCGAACTACGCGGGGGGACCCGGACGGAGGTATAGGTCAGGGGAGGGCGTCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl