Prev. |  KEGG KO K03966 > 

RIKEN DNA Bank Human Resource - NDUFB10

Gene ID NCBI Gene 4716 |  KEGG hsa:4716
Gene Symbol NDUFB10
Protein Name NADH:ubiquinone oxidoreductase subunit B10
Synonyms PDSW
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Ortholog resource in our bank

  NDUFB10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081403 IRAL003I11 pOTB7 BC005829 NM_004548 Full
HGY084328 IRAL010N16 pOTB7 BC007509 NM_004548 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047258 ARe18C10 pKA1U5 NM_004548.2  
GCGCAGACGCAGCCGCCCTCGGCGTCCTCTGTAGCGGGCGACCTAGGCCGCGGGACCCGG
HKR058505 ARe46E09 pKA1U5 NM_004548.2  
TGACCCGGACGGAGGTAGAGGCCAGGGCAGCGCGTCCGGGAGCGGAGTCCGCGCCCGCCG
HKR365777 RBd14H09 pGCAP10 NM_004548.2  
GAGGCCGCGGGACCCGGACGGAGGTAGAGGCCAGGGCAGCGCGTCCGGAGCGGAGTCCGC
HKR374457 RBd36C09 pGCAP10 NM_004548.2  
GAGCGGGCGAACTACGCGGGGGGACCCGGACGGAGGTATAGGTCAGGGGAGGGCGTCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl