Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFB10

Gene ID (NCBI) 4716
Gene Symbol NDUFB10
Protein Name NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
Synonyms PDSW
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081403 IRAL003I11 pOTB7 BC005829 NM_004548 Full
HGY084328 IRAL010N16 pOTB7 BC007509 NM_004548 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR047258 ARe18C10 pKA1U5 NM_004548.2
GCGCAGACGCAGCCGCCCTCGGCGTCCTCTGTAGCGGGCGACCTAGGCCGCGGGACCCGG
HKR058505 ARe46E09 pKA1U5 NM_004548.2
TGACCCGGACGGAGGTAGAGGCCAGGGCAGCGCGTCCGGGAGCGGAGTCCGCGCCCGCCG
HKR365777 RBd14H09 pGCAP10 NM_004548.2
GAGGCCGCGGGACCCGGACGGAGGTAGAGGCCAGGGCAGCGCGTCCGGAGCGGAGTCCGC
HKR374457 RBd36C09 pGCAP10 NM_004548.2
GAGCGGGCGAACTACGCGGGGGGACCCGGACGGAGGTATAGGTCAGGGGAGGGCGTCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl