Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02358

HP ID(1) HP02358
Gene ID(2) 5721
Gene Symbol finder PSME2
Protein Name proteasome (prosome, macropain) activator subunit 2 (PA28 beta)
RefSeq NM_002818.2
Length of RefSeq (bp) 829
Chromosome 14q11.2
Reference DDBJ accession
UniGene Hs.434081

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi44G12 pGCAP10 GGAGACCAGAGATCTAGCGACTGAAGCAGCATGGCCAAGCCGTGTGGGGTGCGCCTGAGC
ARi56D07 pGCAP10 GAGAGATCTAGCGACTGAAGCAGCATGGCCAAGCCGTGTGGGGTGCGCCTGAGCGGGGAA
ARi60D04 pGCAP10 GGGGAGACCAGAGATCTAGCGACTGAAGCAGCATGGCCAAGCCGTGTGGGGTGCGCCTGA
RBd16A04 pGCAP10 GAGAGATCTAGCGACTGAAGCAGCATGGCCAAGCCGTGTGGGGTGCGCCTGAGCGGGGAA
RBd91E10 pGCAP10 GAGAGATCTAGCGACTGAAGCAGCATGGCCAAGCCGTGTGGGGTGCGCCTGAGCGGGGAA
RBdS014K04 pGCAP10 GAGAGATCTAGCGACTGAAGCAGCATGGCCAAGCCGTGTGGGGTGCGCCTGAGCGGGGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl