Prev. |  KEGG KO K06697 > 

RIKEN DNA Bank Human Resource - PSME2

Gene ID NCBI Gene 5721 |  KEGG hsa:5721
Gene Symbol PSME2
Protein Name proteasome activator subunit 2
Synonyms PA28B|PA28beta|REGbeta
Ortholog resources KEGG ortholog (KEGG orthology K06697) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX017017 IRAK042J01 pCMV-SPORT6 BC019885 NM_002818 Full/var
HGY085386 IRAL013H18 pOTB7 BC004368 NM_002818 Full/var
HGY103420 IRAL058J04 pOTB7 BC072025 NM_002818 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR177756 ARi44G12 pGCAP10 NM_002818.2  
GGAGACCAGAGATCTAGCGACTGAAGCAGCATGGCCAAGCCGTGTGGGGTGCGCCTGAGC
HKR182479 ARi56D07 pGCAP10 NM_002818.2  
GAGAGATCTAGCGACTGAAGCAGCATGGCCAAGCCGTGTGGGGTGCGCCTGAGCGGGGAA
HKR184076 ARi60D04 pGCAP10 NM_002818.2  
GGGGAGACCAGAGATCTAGCGACTGAAGCAGCATGGCCAAGCCGTGTGGGGTGCGCCTGA
HKR366404 RBd16A04 pGCAP10 NM_002818.2  
GAGAGATCTAGCGACTGAAGCAGCATGGCCAAGCCGTGTGGGGTGCGCCTGAGCGGGGAA
HKR396506 RBd91E10 pGCAP10 NM_002818.2  
GAGAGATCTAGCGACTGAAGCAGCATGGCCAAGCCGTGTGGGGTGCGCCTGAGCGGGGAA
HKR405844 RBdS014K04 pGCAP10 NM_002818.2  
GAGAGATCTAGCGACTGAAGCAGCATGGCCAAGCCGTGTGGGGTGCGCCTGAGCGGGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl