Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02357

HP ID(1) HP02357
Gene ID(2) 11235
Gene Symbol finder PDCD10
Protein Name programmed cell death 10
RefSeq NM_145859.1
Length of RefSeq (bp) 1313
Chromosome 3q26.1
Reference DDBJ accession
UniGene Hs.478150

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe48A06 pKA1U5 GGGGAGTTGAAGAGGGCTGCAAGGTGGGAAGTGAAGTCAGTGCCTCAGTTGCTGCTTTCT
ARi69A01 pGCAP10 GGGTCCTTCCGGCGTCGCCGGAGTGAATTGATCCGGGAGTTGAAGAGGGCTGCAAGGTGG
ARiS049D03 pGCAP10 GCCTTCCGGCGTCGCCGGAGTGAATTGATCCGGGAGTTGAAGAGGGCTGCAAGGTGGGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl