Prev. |  KEGG KO K18269 > 

RIKEN DNA Bank Human Resource - PDCD10

Gene ID NCBI Gene 11235 |  KEGG hsa:11235
Gene Symbol PDCD10
Protein Name programmed cell death 10
Synonyms CCM3|TFAR15
Ortholog resource in our bank

  PDCD10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081841 IRAL004K01 pOTB7 BC002506 NM_145860 Full
HGY093018 IRAL032J02 pDNR-LIB BC016353 NM_145860 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059206 ARe48A06 pKA1U5 NM_145859.1  
GGGGAGTTGAAGAGGGCTGCAAGGTGGGAAGTGAAGTCAGTGCCTCAGTTGCTGCTTTCT
HKR187601 ARi69A01 pGCAP10 NM_145859.1  
GGGTCCTTCCGGCGTCGCCGGAGTGAATTGATCCGGGAGTTGAAGAGGGCTGCAAGGTGG
HKR219675 ARiS049D03 pGCAP10 NM_145859.1  
GCCTTCCGGCGTCGCCGGAGTGAATTGATCCGGGAGTTGAAGAGGGCTGCAAGGTGGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl