Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02353

HP ID(1) HP02353
Gene ID(2) 6184
Gene Symbol finder RPN1
Protein Name ribophorin I
RefSeq NM_002950.3
Length of RefSeq (bp) 2372
Chromosome 3q21.3
Reference DDBJ accession
UniGene Hs.518244

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe65F01 pKA1U5 GGCACTGCTCTTCCCGGGTCATGGAGGCGCCAGCCNTTNGACATTGTTTCTGCTCCTGTT
ARe86H03 pKA1U5 GGNTNTTCCCGGTTCATGGAGGCGCCAGCCGCCNGNCTTGTTTCTGCTCCTGTTGCTTGG
ARf04D06 pKA1U5 TGGGGCTACCGCGCCCGGGCCCTACCCGCCCTGGCGCACTGCTCTTCCCGGTCATGGAGG
ARi34A05 pGCAP10 GACCCGCCCTGGCGCACTGCTCTTCCCGGTCATGGAGGCGCCAGCCGCCGGCTTGTTTCT
ARiS020O20 pGCAP10 GCTTCCCGGTCATGGAGGCGCCAGCCGCCGGCTTGTTTCTGCTCCTGTTGCTTGGGACTT
RBb25D10 pGCAP1 GGCCCGGGCCCTACCCGCCCTGGCGCACTGCTCTTCCCGGTCATGGAGGCGCCAGCCGCC
RBd15F01 pGCAP10 GGGGCTACCGCGCCCGGGCCCTACCCGCCCTGGCGCACTGCTCTTCCCGGTCATGGAGGC
RBdS110C13 pGCAP10 GCCGGTCATGGAGGCGCCAGCCGCCGGCTTGTTTCTGCTCCTGTTGCTTGGGACTTGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl