Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02349

HP ID(1) HP02349
Gene ID(2) 11014
Gene Symbol finder KDELR2
Protein Name KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
RefSeq NM_006854.3
Length of RefSeq (bp) 2874
Chromosome 7p22.1
Reference DDBJ accession
UniGene Hs.654552

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe08D12 pKA1U5 GGCCACGATCCCGGNCTATCTCCCCATCTTCGCCNCCTTCACTCNCNGGGGCCGCCGCCT
ARe36A01 pKA1U5 GGCCATCTTCGCCGCTTCCTCTCAGGGGCCGCCGCCTCCTGAGCCGCCCAGCCCCGGGGC
ARe56E01 pKA1U5 GGAGCCGCCCAGCCCCGGGGCCGCCGCGCTGCGCCGTACNGCCACCGCCGCCGCCGCCAT
ARi03E04 pGCAP10 GACGTCCCTGGCCACGTCGCGGGCGATCTCGCCATCTTCGCCGCTTCCTCTCAGGGGCCG
ARiS122B15 pGCAP10 GGCCATCTTCGCCGCTTCCTCTCAGGGGCCGCCGCCTCCTGAGCCGCCCAGCCCCGGGGC
RBb24C01 pGCAP1 GAGCCCCGGGGCCGCCGCGCTGCGCCGACCGCCACCGCCGCCGCCGCCATGAACATTTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl