DNA Bank Top |  KEGG KO K10949 > 

RIKEN DNA Bank Human Resource - KDELR2

Gene ID NCBI Gene 11014 |  KEGG hsa:11014
Gene Symbol KDELR2
Protein Name KDEL endoplasmic reticulum protein retention receptor 2
Synonyms ELP-1|ELP1|ERD2.2|OI21

Link

Ortholog resource in our bank

  KDELR2


External database

human KDELR2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB20107 EGFP-VSVG-KDELR2 Expression vector for mammalian cells. Preproglucagon signal sequence, EGFP, luminal region of VSVG (tsO45), TM and cytoplasmic region of human KDELR2. NM_006854.4 full cds

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081359 IRAL003G15 pOTB7 BC008081 NM_006854 Full
HGY084534 IRAL011F14 pOTB7 BC012994 NM_006854 Full/var
HGY103358 IRAL058G14 pOTB7 BC071982 NM_006854 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043284 ARe08D12 pKA1U5 NM_006854.3  
GGCCACGATCCCGGNCTATCTCCCCATCTTCGCCNCCTTCACTCNCNGGGGCCGCCGCCT
HKR054401 ARe36A01 pKA1U5 NM_006854.3  
GGCCATCTTCGCCGCTTCCTCTCAGGGGCCGCCGCCTCCTGAGCCGCCCAGCCCCGGGGC
HKR062497 ARe56E01 pKA1U5 NM_006854.3  
GGAGCCGCCCAGCCCCGGGGCCGCCGCGCTGCGCCGTACNGCCACCGCCGCCGCCGCCAT
HKR161300 ARi03E04 pGCAP10 NM_006854.3  
GACGTCCCTGGCCACGTCGCGGGCGATCTCGCCATCTTCGCCGCTTCCTCTCAGGGGCCG
HKR248839 ARiS122B15 pGCAP10 NM_006854.3  
GGCCATCTTCGCCGCTTCCTCTCAGGGGCCGCCGCCTCCTGAGCCGCCCAGCCCCGGGGC
HKR329649 RBb24C01 pGCAP1 NM_006854.3  
GAGCCCCGGGGCCGCCGCGCTGCGCCGACCGCCACCGCCGCCGCCGCCATGAACATTTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl