Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02330

HP ID(1) HP02330
Gene ID(2) 9601
Gene Symbol finder PDIA4
Protein Name protein disulfide isomerase family A, member 4
RefSeq NM_004911.4
Length of RefSeq (bp) 2970
Chromosome 7q35
Reference DDBJ accession
UniGene Hs.93659

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi36G12 pGCAP10 GAAGGAGCGACGGGCTGTCGGCCAGACCCCGAGTTCTCGGTGCGCTCAGCGGCCGCCGAC
ARi57D04 pGCAP10 GGTCGGCCAGACCCCGAGTTCTCGGTGCGCTCAGCGGCCGCCGACGCTAGGAGGCCGCGC
RBd59G06 pGCAP10 GGTCGGCCAGACCCCGAGTTCTCGGTGCGCTCAGCGGCCGCCGACGCTAGGAGGCCGCGC
RBdS110J22 pGCAP10 TTTTTTCCGGCTCCCCCGCGTCGCTAAGGAGCGACGGGCTGTCGGCCAGACCCCGAGTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl