Prev. |  KEGG KO K09582 > 

RIKEN DNA Bank Human Resource - PDIA4

Gene ID NCBI Gene 9601 |  KEGG hsa:9601
Gene Symbol PDIA4
Protein Name protein disulfide isomerase family A member 4
Synonyms ERP70|ERP72|ERp-72
Ortholog resources KEGG ortholog (KEGG orthology K09582) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080425 IRAL001B01 pOTB7 BC000425 NM_004911 Full
HGY083705 IRAL009E09 pOTB7 BC001928 NM_004911 Full
HGY086824 IRAL017A24 pOTB7 BC006344 NM_004911 Full
HGY090882 IRAL027D10 pOTB7 BC011754 NM_004911 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR174556 ARi36G12 pGCAP10 NM_004911.4  
GAAGGAGCGACGGGCTGTCGGCCAGACCCCGAGTTCTCGGTGCGCTCAGCGGCCGCCGAC
HKR182876 ARi57D04 pGCAP10 NM_004911.4  
GGTCGGCCAGACCCCGAGTTCTCGGTGCGCTCAGCGGCCGCCGACGCTAGGAGGCCGCGC
HKR383750 RBd59G06 pGCAP10 NM_004911.4  
GGTCGGCCAGACCCCGAGTTCTCGGTGCGCTCAGCGGCCGCCGACGCTAGGAGGCCGCGC
HKR444238 RBdS110J22 pGCAP10 NM_004911.4  
TTTTTTCCGGCTCCCCCGCGTCGCTAAGGAGCGACGGGCTGTCGGCCAGACCCCGAGTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl