Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02306

HP ID(1) HP02306
Gene ID(2) 4694
Gene Symbol finder NDUFA1
Protein Name NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa
RefSeq NM_004541.3
Length of RefSeq (bp) 502
Chromosome Xq24
Reference DDBJ accession
UniGene Hs.534168

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe15E07 pKA1U5 ACCTTTCAGGACCCAGAAGTAGGGTTTTGGCCNATNTAACGGGGCAGAGATGTGGTTCGA
ARe21B09 pKA1U5 TACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTC
ARe63H06 pKA1U5 GACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTC
ARe70C08 pKA1U5 ACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCG
ARi20D11 pGCAP10 GGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGA
ARi68H10 pGCAP10 GGCTGGGAAGAGAGGCGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCC
RBb14D01 pKA1U5 GAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGT
RBb19F04 pKA1U5 ACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTTAACGGGGCAGAGATGTGGTTC
RBb24D05 pGCAP1 GGGGGCTTGCTGGGAAGAGAGGCGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGT
RBb26D10 pGCAP1 GGTCCCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGT
RBb64E08 pGCAP1 AAATGTGGTACTTTTTTGAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGA
RBb70A01 pGCAP1
RBd04E06 pGCAP10 GGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCTCCGTC
RBd05C06 pGCAP10 GAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCTCC
RBd34C10 pGCAP10 TGGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCTCC
RBd43G08 pGCAP10 GAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCTCC
RBd59E04 pGCAP10 TGAGCCGTACGTGGCACCGCCCCGCTCGCGGGCGGCCGCGGGGCTTGCTGGGAAGAGAGG
RBd79F04 pGCAP10 GGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAG
RBd85D02 pGCAP10 CAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTC
RBd87D04 pGCAP10 TTGGTTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCTCC
RBd90G01 pGCAP10 GGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAG
RBdS015P11 pGCAP10 CGGCCGGCCGATGGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAG
RBdS040C17 pGCAP10 GAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGT
RBdS040J20 pGCAP10 GNCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGT
RBdS051K04 pGCAP10 GGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAG
RBdS051N02 pGCAP10 GAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTC
RBdS070G05 pGCAP10 TGCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGT
RBdS070M10 pGCAP10 GTGAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGAT
RBdS075M15 pGCAP10 GAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTC
RBdS083F16 pGCAP10 AGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTG
RBdS104B05 pGCAP10 GGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCT
RBdS105B02 pGCAP10 GAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGA
RBdS105N12 pGCAP10 GAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTC
RBdS177O20 pGCAP10 GAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGA
RBdS187P20 pGCAP10 GAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTC
RBdS187J17 pGCAP10 GAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl