Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFA1

Gene ID (NCBI) 4694
Gene Symbol NDUFA1
Protein Name NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa
Synonyms CI-MWFE|MWFE|ZNF183
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082699 IRAL006M11 pOTB7 BC000266 NM_004541 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE097208 M01C043A08 pDONR221 MGC11-B04 BC000266 NM_004541
HGE097256 M01C043C08 pDONR221 MGC11-B04 BC000266 NM_004541
HGE097304 M01C043E08 pDONR221 MGC11-B04 BC000266 NM_004541
HGE097352 M01C043G08 pDONR221 MGC11-B04 BC000266 NM_004541
HGE097400 M01C043I08 pDONR221 MGC11-B04 BC000266 NM_004541
HGE097448 M01C043K08 pDONR221 MGC11-B04 BC000266 NM_004541
HGE097496 M01C043M08 pDONR221 MGC11-B04 BC000266 NM_004541
HGE097544 M01C043O08 pDONR221 MGC11-B04 BC000266 NM_004541

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR046103 ARe15E07 pKA1U5 NM_004541.3
ACCTTTCAGGACCCAGAAGTAGGGTTTTGGCCNATNTAACGGGGCAGAGATGTGGTTCGA
HKR048433 ARe21B09 pKA1U5 NM_004541.3
TACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTC
HKR168083 ARi20D11 pGCAP10 NM_004541.3
GGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGA
HKR065374 ARe63H06 pKA1U5 NM_004541.3
GACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTC
HKR187378 ARi68H10 pGCAP10 NM_004541.3
GGCTGGGAAGAGAGGCGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCC
HKR068056 ARe70C08 pKA1U5 NM_004541.3
ACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCG
HKR361702 RBd04E06 pGCAP10 NM_004541.3
GGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCTCCGTC
HKR362054 RBd05C06 pGCAP10 NM_004541.3
GAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCTCC
HKR325673 RBb14D01 pKA1U5 NM_004541.3
GAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGT
HKR327724 RBb19F04 pKA1U5 NM_004541.3
ACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTTAACGGGGCAGAGATGTGGTTC
HKR329677 RBb24D05 pGCAP1 NM_004541.3
GGGGGCTTGCTGGGAAGAGAGGCGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGT
HKR330482 RBb26D10 pGCAP1 NM_004541.3
GGTCCCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGT
HKR373658 RBd34C10 pGCAP10 NM_004541.3
TGGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCTCC
HKR377352 RBd43G08 pGCAP10 NM_004541.3
GAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCTCC
HKR383700 RBd59E04 pGCAP10 NM_004541.3
TGAGCCGTACGTGGCACCGCCCCGCTCGCGGGCGGCCGCGGGGCTTGCTGGGAAGAGAGG
HKR345704 RBb64E08 pGCAP1 NM_004541.3
AAATGTGGTACTTTTTTGAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGA
HKR348001 RBb70A01 pGCAP1 NM_004541.3
HKR391724 RBd79F04 pGCAP10 NM_004541.3
GGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAG
HKR394074 RBd85D02 pGCAP10 NM_004541.3
CAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTC
HKR394876 RBd87D04 pGCAP10 NM_004541.3
TTGGTTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCTCC
HKR396145 RBd90G01 pGCAP10 NM_004541.3
GGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAG
HKR406371 RBdS015P11 pGCAP10 NM_004541.3
CGGCCGGCCGATGGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAG
HKR416065 RBdS040C17 pGCAP10 NM_004541.3
GAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGT
HKR416236 RBdS040J20 pGCAP10 NM_004541.3
GNCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGT
HKR420644 RBdS051K04 pGCAP10 NM_004541.3
GGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAG
HKR420714 RBdS051N02 pGCAP10 NM_004541.3
GAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTC
HKR428149 RBdS070G05 pGCAP10 NM_004541.3
TGCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGT
HKR428298 RBdS070M10 pGCAP10 NM_004541.3
GTGAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGAT
HKR430303 RBdS075M15 pGCAP10 NM_004541.3
GAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTC
HKR433336 RBdS083F16 pGCAP10 NM_004541.3
AGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTG
HKR441629 RBdS104B05 pGCAP10 NM_004541.3
GGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCT
HKR442026 RBdS105B02 pGCAP10 NM_004541.3
GAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGA
HKR442324 RBdS105N12 pGCAP10 NM_004541.3
GAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTC
HKR471156 RBdS177O20 pGCAP10 NM_004541.3
GAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGA
HKR475033 RBdS187J17 pGCAP10 NM_004541.3
GAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTC
HKR475180 RBdS187P20 pGCAP10 NM_004541.3
GAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl