Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02248

HP ID(1) HP02248
Gene ID(2) 51070
Gene Symbol finder NOSIP
Protein Name nitric oxide synthase interacting protein
RefSeq NM_015953.3
Length of RefSeq (bp) 1116
Chromosome 19q13.33
Reference DDBJ accession
UniGene Hs.7236

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd27D06 pGCAP10 GACAGTTGAAGAAGCGACCGAGGGACTGGGAGTCGTTAGTGAGGATGACGCGGCATGGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl