Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NOSIP

Gene ID (NCBI) 51070
Gene Symbol NOSIP
Protein Name nitric oxide synthase interacting protein
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX007623 IRAK019A23 pCMV-SPORT6 BC011249 NM_015953 Full/var
HGY090547 IRAL026G03 pOTB7 BC009299 NM_015953 Full
HGY091147 IRAL027O11 pOTB7 BC010077 NM_015953

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR370878 RBd27D06 pGCAP10 NM_015953.3  
GACAGTTGAAGAAGCGACCGAGGGACTGGGAGTCGTTAGTGAGGATGACGCGGCATGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.02.17

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl