Prev. |  KEGG KO K13125 > 

RIKEN DNA Bank Human Resource - NOSIP

Gene ID NCBI Gene 51070 |  KEGG hsa:51070
Gene Symbol NOSIP
Protein Name nitric oxide synthase interacting protein
Synonyms CGI-25
Ortholog resource in our bank

  NOSIP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007623 IRAK019A23 pCMV-SPORT6 BC011249 NM_015953 Full/var
HGY090547 IRAL026G03 pOTB7 BC009299 NM_015953 Full
HGY091147 IRAL027O11 pOTB7 BC010077 NM_015953

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR370878 RBd27D06 pGCAP10 NM_015953.3  
GACAGTTGAAGAAGCGACCGAGGGACTGGGAGTCGTTAGTGAGGATGACGCGGCATGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl