Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02207

HP ID(1) HP02207
Gene ID(2) 7284
Gene Symbol finder TUFM
Protein Name Tu translation elongation factor, mitochondrial
RefSeq NM_003321.4
Length of RefSeq (bp) 2089
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.12084

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe42D06 pKA1U5 GAGCCGCAGGCGCCCTTCTTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTA
ARiS008F08 pGCAP10 GAGGCGCCCTTCTTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTACCGGGG
RBb31G12 pGCAP1 GGCAGGCGCCCTTCCTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTTACCG
RBb55F01 pGCAP1 GCTTCAGCCGCAGGCGCCCTTCTTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCG
RBb58B01 pGCAP1 GCCAGCCGCAGGCGCCCTTCCTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGT
RBd83H12 pGCAP10 GGCCTTCCAGCCGCAGGCGCCCTTCCTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCC
RBd91C06 pGCAP10 GAGGCGCCCTTCTTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTACCGGGG
RBdS187E02 pGCAP10 GAGGCGCCCTTCCTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTACCGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl