Prev. |  KEGG KO K02358 > 

RIKEN DNA Bank Human Resource - TUFM

Gene ID NCBI Gene 7284 |  KEGG hsa:7284
Gene Symbol TUFM
Protein Name Tu translation elongation factor, mitochondrial
Synonyms COXPD4|EF-TuMT|EFTU|P43
Ortholog resource in our bank

  TUFM

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083235 IRAL008B11 pOTB7 BC001633 NM_003321 Full
HGY090947 IRAL027G03 pOTB7 BC010041 NM_003321

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056878 ARe42D06 pKA1U5 NM_003321.4  
GAGCCGCAGGCGCCCTTCTTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTA
HKR203328 ARiS008F08 pGCAP10 NM_003321.4  
GAGGCGCCCTTCTTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTACCGGGG
HKR332556 RBb31G12 pGCAP1 NM_003321.4  
GGCAGGCGCCCTTCCTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTTACCG
HKR342121 RBb55F01 pGCAP1 NM_003321.4  
GCTTCAGCCGCAGGCGCCCTTCTTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCG
HKR343225 RBb58B01 pGCAP1 NM_003321.4  
GCCAGCCGCAGGCGCCCTTCCTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGT
HKR393380 RBd83H12 pGCAP10 NM_003321.4  
GGCCTTCCAGCCGCAGGCGCCCTTCCTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCC
HKR396454 RBd91C06 pGCAP10 NM_003321.4  
GAGGCGCCCTTCTTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTACCGGGG
HKR474898 RBdS187E02 pGCAP10 NM_003321.4  
GAGGCGCCCTTCCTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTACCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl