Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02205

HP ID(1) HP02205
Gene ID(2) 55898
Gene Symbol finder UNC45A
Protein Name unc-45 homolog A (C. elegans)
RefSeq NM_018671.3
Length of RefSeq (bp) 3585
Chromosome 15q26.1
Reference DDBJ accession
UniGene Hs.389461

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe61B08 pKA1U5 TGAGAGACTGCGCCTGCGCGGGCACGAGACACCCTCTCCGCGATGACTGCCAGCTCAGTG
ARi32E06 pGCAP10 GGCCCCGCCCCAGAGACTGCGCCTGCGCGGGCACGAGACACCCTCTCCGCGATGACTGCC
RBb66F03 pGCAP1 GCGCTCATGGCCCTAACAAACCTGGCTGGGATCAGCGAGAGGCTCCGGCAGAAGATCCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl