Prev. | 

RIKEN DNA Bank Human Resource - UNC45A

Gene ID NCBI Gene 55898 |  KEGG hsa:55898
Gene Symbol UNC45A
Protein Name unc-45 myosin chaperone A
Synonyms GC-UNC45|GCUNC-45|GCUNC45|IRO039700|SMAP-1|SMAP1|UNC-45A
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY025528 IRAK063N16 pBluescriptR BC045635 NM_001039675 Full
HGX031572 IRAK078P12 pCMV-SPORT6 BC037992 NM_018671 Full
HGY081805 IRAL004I13 pOTB7 BC006214 NM_018671 Full
HGY090159 IRAL025G15 pOTB7 BC010995 NM_018671 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064432 ARe61B08 pKA1U5 NM_018671.3  
TGAGAGACTGCGCCTGCGCGGGCACGAGACACCCTCTCCGCGATGACTGCCAGCTCAGTG
HKR172902 ARi32E06 pGCAP10 NM_018671.3  
GGCCCCGCCCCAGAGACTGCGCCTGCGCGGGCACGAGACACCCTCTCCGCGATGACTGCC
HKR346523 RBb66F03 pGCAP1 NM_018671.3  
GCGCTCATGGCCCTAACAAACCTGGCTGGGATCAGCGAGAGGCTCCGGCAGAAGATCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl