Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02190

HP ID(1) HP02190
Gene ID(2) 140739
Gene Symbol finder UBE2F
Protein Name ubiquitin-conjugating enzyme E2F (putative)
RefSeq NM_080678.1
Length of RefSeq (bp) 1366
Chromosome 2q37.3
Reference DDBJ accession
UniGene Hs.471785

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb58B06 pGCAP1 GCCCGCCACTTCCGGTCCCGCCGCCGGGAGCCGGTGCGGCTGTGAGGGGCCGCGTCTCGC
RBdS013N16 pGCAP10 GGCCNNNGGGAGCCGGTGCGGCTGTGAGGGGCCGCGTCTCGCAGCAGCCGCCCGGACCGG
RBdS070O06 pGCAP10 GGCCACTTCCGGTCCCGCCGCCGGGAGCCGGTGCGGCTGTGAGGGGCCGCGTCTCGCAGC
RBdS177A17 pGCAP10 GCCGCCGCCGGGAGCCGGTGCGGCTGTGAGGGGCCGCGTCTCGCAGCAGCCGCCCGGACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl