Prev. |  KEGG KO K10687 > 

RIKEN DNA Bank Human Resource - UBE2F

Gene ID NCBI Gene 140739 |  KEGG hsa:140739
Gene Symbol UBE2F
Protein Name ubiquitin conjugating enzyme E2 F (putative)
Synonyms NCE2
Ortholog resource in our bank

  UBE2F

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007966 IRAK019P06 pCMV-SPORT6 BC010549 NM_080678

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR343230 RBb58B06 pGCAP1 NM_080678.1  
GCCCGCCACTTCCGGTCCCGCCGCCGGGAGCCGGTGCGGCTGTGAGGGGCCGCGTCTCGC
HKR405528 RBdS013N16 pGCAP10 NM_080678.1  
GGCCNNNGGGAGCCGGTGCGGCTGTGAGGGGCCGCGTCTCGCAGCAGCCGCCCGGACCGG
HKR428342 RBdS070O06 pGCAP10 NM_080678.1  
GGCCACTTCCGGTCCCGCCGCCGGGAGCCGGTGCGGCTGTGAGGGGCCGCGTCTCGCAGC
HKR470817 RBdS177A17 pGCAP10 NM_080678.1  
GCCGCCGCCGGGAGCCGGTGCGGCTGTGAGGGGCCGCGTCTCGCAGCAGCCGCCCGGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl