Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02186

HP ID(1) HP02186
Gene ID(2) 51491
Gene Symbol finder NOP16
Protein Name NOP16 nucleolar protein homolog (yeast)
RefSeq NM_016391.4
Length of RefSeq (bp) 537
Chromosome 5q35.2
Reference DDBJ accession
UniGene Hs.696283

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe52B03 pKA1U5 GATAGGCAGCGTGTTTGAGCTGCTGGTGCGGTGNTCANNGCGATGCCCAAGGCCAAGGGC
ARi07B11 pGCAP10 TGGACACGAGGTCTGAGAGACAGAGGCAGCGTGTTTGAGCTGCTGGTGCGGTGGTCAGCG
RBd13A10 pGCAP10 GAGCGTGTTTGAGCTGCTGGTGCGGTGGTCAGCGCGATGCCCAAGGCCAAGGGCAAAACC
RBdS105G13 pGCAP10 GAGGTCTGAGAGACAGAGGCAGCGTGTTTGAGCTGCTGGTGCGGTGGTCAGCGCGATGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl