Prev. | 

RIKEN DNA Bank Human Resource - NOP16

Gene ID NCBI Gene 51491 |  KEGG hsa:51491
Gene Symbol NOP16
Protein Name NOP16 nucleolar protein
Synonyms HSPC111|HSPC185
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025963 IRAK064P03 pCMV-SPORT6 BC032424 NM_016391 Full/var
HGX033971 IRAK084P11 pCMV-SPORT6 BC040106 NM_016391 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024456 W01A061C08 pENTR-TOPO IRAK084P11 BC040106 NM_016391  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060827 ARe52B03 pKA1U5 NM_016391.4  
GATAGGCAGCGTGTTTGAGCTGCTGGTGCGGTGNTCANNGCGATGCCCAAGGCCAAGGGC
HKR162835 ARi07B11 pGCAP10 NM_016391.4  
TGGACACGAGGTCTGAGAGACAGAGGCAGCGTGTTTGAGCTGCTGGTGCGGTGGTCAGCG
HKR365210 RBd13A10 pGCAP10 NM_016391.4  
GAGCGTGTTTGAGCTGCTGGTGCGGTGGTCAGCGCGATGCCCAAGGCCAAGGGCAAAACC
HKR442157 RBdS105G13 pGCAP10 NM_016391.4  
GAGGTCTGAGAGACAGAGGCAGCGTGTTTGAGCTGCTGGTGCGGTGGTCAGCGCGATGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl