Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02150

HP ID(1) HP02150
Gene ID(2) 4722
Gene Symbol finder NDUFS3
Protein Name NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
RefSeq NM_004551.1
Length of RefSeq (bp) 899
Chromosome 11p11.11
Reference DDBJ accession
UniGene Hs.502528

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe31E05 pKA1U5 GGTCCTGCTGTCTTTCCGTCCGCTGCCTAGTCTGCATCTGAGTAACATGGCGGCGGCGGC
ARiS085O04 pGCAP10 GGCATCTGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGATCTTGG
ARiS150E05 pGCAP10 GAGTCTGCATCTGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGAT
RBb19G04 pKA1U5 GCTGCATCTGAGTAACATGGCGGCGGCGGCGGCCNNTNGGCTGTGGTGGCGCGGGATCTT
RBb25B02 pGCAP1 GGTCTGCATCTGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGATC
RBb46C11 pGCAP1
RBb69C05 pGCAP1 GAGAGAGCGGGGGAGGGGTGTGTAGCGTAGAACCCAGAACGCCCGCCCCCTCCCCTCCTC
RBd66A03 pGCAP10 GATCTGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGATCTTGGGG
RBd76E10 pGCAP10 TGATCTGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGATCTTGGG
RBdS075C01 pGCAP10 GGGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGATCTTGGGGGCC
RBdS156A24 pGCAP10 GATCTGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGATCTTGGGG
RBdS156F18 pGCAP10 GATCTGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGATCTTGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl