Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFS3

Gene ID (NCBI) 4722
Gene Symbol NDUFS3
Protein Name NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
Synonyms CI-30
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082250 IRAL005K10 pOTB7 BC000617 NM_004551 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE000841 W01A002B17 pENTR-TOPO IRAL005K10 BC000617 NM_004551
HGE000843 W01A002B19 pENTR-TOPO IRAL005K10 BC000617 NM_004551

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR052501 ARe31E05 pKA1U5 NM_004551.1
GGTCCTGCTGTCTTTCCGTCCGCTGCCTAGTCTGCATCTGAGTAACATGGCGGCGGCGGC
HKR234340 ARiS085O04 pGCAP10 NM_004551.1
GGCATCTGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGATCTTGG
HKR260101 ARiS150E05 pGCAP10 NM_004551.1
GAGTCTGCATCTGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGAT
HKR327748 RBb19G04 pKA1U5 NM_004551.1
GCTGCATCTGAGTAACATGGCGGCGGCGGCGGCCNNTNGGCTGTGGTGGCGCGGGATCTT
HKR330026 RBb25B02 pGCAP1 NM_004551.1
GGTCTGCATCTGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGATC
HKR338459 RBb46C11 pGCAP1 NM_004551.1
HKR347653 RBb69C05 pGCAP1 NM_004551.1
GAGAGAGCGGGGGAGGGGTGTGTAGCGTAGAACCCAGAACGCCCGCCCCCTCCCCTCCTC
HKR386403 RBd66A03 pGCAP10 NM_004551.1
GATCTGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGATCTTGGGG
HKR390506 RBd76E10 pGCAP10 NM_004551.1
TGATCTGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGATCTTGGG
HKR430049 RBdS075C01 pGCAP10 NM_004551.1
GGGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGATCTTGGGGGCC
HKR462424 RBdS156A24 pGCAP10 NM_004551.1
GATCTGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGATCTTGGGG
HKR462538 RBdS156F18 pGCAP10 NM_004551.1
GATCTGAGTAACATGGCGGCGGCGGCGGTAGCCAGGCTGTGGTGGCGCGGGATCTTGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl