Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02082

HP ID(1) HP02082
Gene ID(2) 58485
Gene Symbol finder TRAPPC1
Protein Name trafficking protein particle complex 1
RefSeq NM_021210.3
Length of RefSeq (bp) 826
Chromosome 17p13.1
Reference DDBJ accession
UniGene Hs.24379

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf04E06 pKA1U5 NNGGNGNTCCCCACCNGGTNGGAANGCTGAGGGNCCGNGAACCCGANCCCAANGAGTGGG
ARi19B09 pGCAP10 AGTTCCGGTGAGTCCGTGGGTGGGGTCCCCACCTGGTTGGAAGGCTGTGGGTCCGGGAAC
ARi36D07 pGCAP10 GACCTGGTTGGAAGGCTGTGGGTCCGGGAACCCGAGCCCAAGGAGTGGGGGCGGCCCCGG
ARi50E06 pGCAP10 GGCAGTTCCGGTGAGTCCGTGGGTGGGGTCCCCACCTGGTTGGAAGGCTGTGGGTCCGGG
ARiS118P01 pGCAP10 GGAGTCCGTGGGTGGGGTCCCCACCTGGTTGGAAGGCTGTGGGTCCGGGAACCCGAGCCC
RBb04G07 pKA1U5 GAGTCCGTGGGTGGGGTCCCCACCTGGTTGGAAGGCTGTGGGTCCGGGAACCCGAGCCCA
RBd11H08 pGCAP10 GGGGTGGGGTCCCCACCTGGTTGGAAGGCTGTGGGTCCGGGAACCCGAGCCCAAGGAGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl