Prev. |  KEGG KO K20300 > 

RIKEN DNA Bank Human Resource - TRAPPC1

Gene ID NCBI Gene 58485 |  KEGG hsa:58485
Gene Symbol TRAPPC1
Protein Name trafficking protein particle complex 1
Synonyms BET5|MUM2
Ortholog resource in our bank

  TRAPPC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027776 IRAK069H08 pCMV-SPORT6 BC032717 NM_021210 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE036099 W01A090E03 pENTR-TOPO IRAK069H08 BC032717 NM_021210  
HGE036115 W01A090E19 pENTR-TOPO IRAK069H08 BC032717 NM_021210  
HGE036117 W01A090E21 pENTR-TOPO IRAK069H08 BC032717 NM_021210  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR081702 ARf04E06 pKA1U5 NM_021210.3  
NNGGNGNTCCCCACCNGGTNGGAANGCTGAGGGNCCGNGAACCCGANCCCAANGAGTGGG
HKR167633 ARi19B09 pGCAP10 NM_021210.3  
AGTTCCGGTGAGTCCGTGGGTGGGGTCCCCACCTGGTTGGAAGGCTGTGGGTCCGGGAAC
HKR174479 ARi36D07 pGCAP10 NM_021210.3  
GACCTGGTTGGAAGGCTGTGGGTCCGGGAACCCGAGCCCAAGGAGTGGGGGCGGCCCCGG
HKR180102 ARi50E06 pGCAP10 NM_021210.3  
GGCAGTTCCGGTGAGTCCGTGGGTGGGGTCCCCACCTGGTTGGAAGGCTGTGGGTCCGGG
HKR247561 ARiS118P01 pGCAP10 NM_021210.3  
GGAGTCCGTGGGTGGGGTCCCCACCTGGTTGGAAGGCTGTGGGTCCGGGAACCCGAGCCC
HKR321751 RBb04G07 pKA1U5 NM_021210.3  
GAGTCCGTGGGTGGGGTCCCCACCTGGTTGGAAGGCTGTGGGTCCGGGAACCCGAGCCCA
HKR364576 RBd11H08 pGCAP10 NM_021210.3  
GGGGTGGGGTCCCCACCTGGTTGGAAGGCTGTGGGTCCGGGAACCCGAGCCCAAGGAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl