Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02065

HP ID(1) HP02065
Gene ID(2) 8682
Gene Symbol finder PEA15
Protein Name phosphoprotein enriched in astrocytes 15
RefSeq NM_003768.3
Length of RefSeq (bp) 2474
Chromosome 1q21.1
Reference DDBJ accession
UniGene Hs.517216

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06F06 pKA1U5 GAGAGGCGGCGGCGGCGGCAGAAGCGGCGGCGGCNGCGGCGGCGGGAGCCGAGGAGGAGG
ARe25C03 pKA1U5 GGAGAGGCGGCGGCGGCGGCAGAAGCGGCGGCGGCGGCGGCGGGAGCCGAGGAGGAGGTT
ARe27H09 pKA1U5 GTCCGCGGGCGGAAGAGGCGGCGGCGGCGGCAGAAGCGGCGGCGGCGGCGGCGGGAGCCG
ARe44B11 pKA1U5 GACCGGCCAGCCGGGTGGAGTGAGCGGCGCTGGGCTCGGGCTCCGGCTCCGCGGGCGGAA
ARe55G02 pKA1U5 GGGCTCCGCGGGCGGAAGAGGCGGCGGCGGCGCCNTAAGCGGCGGCGGCGGCGGCGGCGG
ARi01D07 pGCAP10 GGGCTCCGCGGGCGGAAGAGGCGGCGGCGGCGGCAGAAGCGGCGGCGGCGGCGGCGGGAG
ARi62G09 pGCAP10 GGGCTCCGCGGGCGGAAGAGGCGGCGGCGGCGGCAGAAGCGGCGGCGGCGGCGGCGGGAG
ARi63C11 pGCAP10 GGGCTCCGCGGGCGGAAGAGGCGGCGGCGGCGGCAGAAGCGGCGGCGGCGGCGGCGGGAG
ARiS045C21 pGCAP10 GGGCGGCGGCNGNNGCGGCGGCGGCGGCGGCGGGAGCCGNGGAGGAGGNTCCGGNCGCNG
RBd87F06 pGCAP10 GAGAAGCGGCGGCGGCGGCGGCGGGAGCCGAGGAGGAGGTTCCGGACGCTGCTTAGGAAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl