Prev. | 

RIKEN DNA Bank Human Resource - PEA15

Gene ID NCBI Gene 8682 |  KEGG hsa:8682
Gene Symbol PEA15
Protein Name proliferation and apoptosis adaptor protein 15
Synonyms HMAT1|HUMMAT1H|MAT1|MAT1H|PEA-15|PED|PED-PEA15|PED/PEA15
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004935 IRAK012F15 pCMV-SPORT6 BC010469 NM_003768 Partial/var
HGY013161 IRAK032P01 pBluescriptR BC022554 NM_003768
HGY082008 IRAL005A08 pOTB7 BC002426 NM_003768 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE003928 W01A009N16 pENTR-TOPO IRAK032P01 BC022554 NM_003768  
HGE036051 W01A090C03 pENTR-TOPO IRAL005A08 BC002426 NM_003768  
HGE036053 W01A090C05 pENTR-TOPO IRAL005A08 BC002426 NM_003768  
HGE036069 W01A090C21 pENTR-TOPO IRAL005A08 BC002426 NM_003768  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042526 ARe06F06 pKA1U5 NM_003768.3  
GAGAGGCGGCGGCGGCGGCAGAAGCGGCGGCGGCNGCGGCGGCGGGAGCCGAGGAGGAGG
HKR050051 ARe25C03 pKA1U5 NM_003768.3  
GGAGAGGCGGCGGCGGCGGCAGAAGCGGCGGCGGCGGCGGCGGGAGCCGAGGAGGAGGTT
HKR050977 ARe27H09 pKA1U5 NM_003768.3  
GTCCGCGGGCGGAAGAGGCGGCGGCGGCGGCAGAAGCGGCGGCGGCGGCGGCGGGAGCCG
HKR057635 ARe44B11 pKA1U5 NM_003768.3  
GACCGGCCAGCCGGGTGGAGTGAGCGGCGCTGGGCTCGGGCTCCGGCTCCGCGGGCGGAA
HKR062146 ARe55G02 pKA1U5 NM_003768.3  
GGGCTCCGCGGGCGGAAGAGGCGGCGGCGGCGCCNTAAGCGGCGGCGGCGGCGGCGGCGG
HKR160479 ARi01D07 pGCAP10 NM_003768.3  
GGGCTCCGCGGGCGGAAGAGGCGGCGGCGGCGGCAGAAGCGGCGGCGGCGGCGGCGGGAG
HKR184953 ARi62G09 pGCAP10 NM_003768.3  
GGGCTCCGCGGGCGGAAGAGGCGGCGGCGGCGGCAGAAGCGGCGGCGGCGGCGGCGGGAG
HKR185259 ARi63C11 pGCAP10 NM_003768.3  
GGGCTCCGCGGGCGGAAGAGGCGGCGGCGGCGGCAGAAGCGGCGGCGGCGGCGGCGGGAG
HKR218069 ARiS045C21 pGCAP10 NM_003768.3  
GGGCGGCGGCNGNNGCGGCGGCGGCGGCGGCGGGAGCCGNGGAGGAGGNTCCGGNCGCNG
HKR394926 RBd87F06 pGCAP10 NM_003768.3  
GAGAAGCGGCGGCGGCGGCGGCGGGAGCCGAGGAGGAGGTTCCGGACGCTGCTTAGGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl