Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02058

HP ID(1) HP02058
Gene ID(2) 26520
Gene Symbol finder TIMM9
Protein Name translocase of inner mitochondrial membrane 9 homolog (yeast)
RefSeq NM_012460.2
Length of RefSeq (bp) 1108
Chromosome 14q21
Reference DDBJ accession
UniGene Hs.440525

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi41E02 pGCAP10 GCTTTTCCCATCTGGCGGCCGCGGCTCCTGTCCAGACCCTGACCCTCCCTCCCAAGGCTC
ARi47F05 pGCAP10 GGTTCTTTCCCATCTGGCGGCCGCGGCTCCTGTCCAGACCCTGACCCTCCCTCCCAAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl