Prev. |  KEGG KO K17777 > 

RIKEN DNA Bank Human Resource - TIMM9

Gene ID NCBI Gene 26520 |  KEGG hsa:26520
Gene Symbol TIMM9
Protein Name translocase of inner mitochondrial membrane 9
Synonyms TIM9|TIM9A
Ortholog resource in our bank

  TIMM9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY096149 IRAL040G05 pOTB7 BC020213 NM_012460
HGY099466 IRAL048L02 pDNR-LIB BC054875 NM_012460 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR176498 ARi41E02 pGCAP10 NM_012460.2  
GCTTTTCCCATCTGGCGGCCGCGGCTCCTGTCCAGACCCTGACCCTCCCTCCCAAGGCTC
HKR178925 ARi47F05 pGCAP10 NM_012460.2  
GGTTCTTTCCCATCTGGCGGCCGCGGCTCCTGTCCAGACCCTGACCCTCCCTCCCAAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl