Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02050

HP ID(1) HP02050
Gene ID(2) 5571
Gene Symbol finder PRKAG1
Protein Name protein kinase, AMP-activated, gamma 1 non-catalytic subunit
RefSeq NM_002733.3
Length of RefSeq (bp) 1707
Chromosome 12q12-q14
Reference DDBJ accession
UniGene Hs.530862

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe42A11 pKA1U5 GGCCTCTTGCAATGGAGACGGTCATTTCTTCAGATAGCTCCCCAGCTGTGGAAAATGAGC
ARe53B02 pKA1U5 ATCCTGGCTCTTGCAATGGAGACGGTCATTTCTTCAGATAGCTCCCCAGCTGTGGAAAAT
ARe56H04 pKA1U5 GCTCTTGCAATGGAGACGGGTCATTTCTTCAGANCCCTTNCCCAGCTGTGGAAAATGAGC
ARi39H08 pGCAP10 GCTTGCAATGGAGACGGTCATTTCTTCAGATAGCTCCCCAGCTGTGGAAAATGAGCATCC
RBd06H09 pGCAP10 GGGGGCCTGCCCCAAGAGAGTTTCCTAAAGCGAGGAAACCAAGCCGGGCGCCTCTTGCAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl