Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PRKAG1

Gene ID (NCBI) 5571
Gene Symbol PRKAG1
Protein Name protein kinase, AMP-activated, gamma 1 non-catalytic subunit
Synonyms AMPKG
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Circadian clock (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080745 IRAL001O09 pOTB7 BC000358 NM_212461 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081234 M01C003B10 pDONR221 04-134-2_2-D05 BC000358 NM_212461  
HGE081282 M01C003D10 pDONR221 04-134-2_2-D05 BC000358 NM_212461  
HGE081330 M01C003F10 pDONR221 04-134-2_2-D05 BC000358 NM_212461  
HGE081378 M01C003H10 pDONR221 04-134-2_2-D05 BC000358 NM_212461  
HGE081426 M01C003J10 pDONR221 04-134-2_2-D05 BC000358 NM_212461  
HGE081474 M01C003L10 pDONR221 04-134-2_2-D05 BC000358 NM_212461  
HGE081522 M01C003N10 pDONR221 04-134-2_2-D05 BC000358 NM_212461  
HGE081570 M01C003P10 pDONR221 04-134-2_2-D05 BC000358 NM_212461  
HGE099619 M01C049A19 pDONR221 MGC14-A10 BC000358 NM_212461  
HGE099667 M01C049C19 pDONR221 MGC14-A10 BC000358 NM_212461  
HGE099715 M01C049E19 pDONR221 MGC14-A10 BC000358 NM_212461  
HGE099763 M01C049G19 pDONR221 MGC14-A10 BC000358 NM_212461  
HGE099811 M01C049I19 pDONR221 MGC14-A10 BC000358 NM_212461  
HGE099859 M01C049K19 pDONR221 MGC14-A10 BC000358 NM_212461  
HGE099907 M01C049M19 pDONR221 MGC14-A10 BC000358 NM_212461  
HGE099955 M01C049O19 pDONR221 MGC14-A10 BC000358 NM_212461  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR175776 ARi39H08 pGCAP10 NM_002733.3  
GCTTGCAATGGAGACGGTCATTTCTTCAGATAGCTCCCCAGCTGTGGAAAATGAGCATCC
HKR056811 ARe42A11 pKA1U5 NM_002733.3  
GGCCTCTTGCAATGGAGACGGTCATTTCTTCAGATAGCTCCCCAGCTGTGGAAAATGAGC
HKR061226 ARe53B02 pKA1U5 NM_002733.3  
ATCCTGGCTCTTGCAATGGAGACGGTCATTTCTTCAGATAGCTCCCCAGCTGTGGAAAAT
HKR062572 ARe56H04 pKA1U5 NM_002733.3  
GCTCTTGCAATGGAGACGGGTCATTTCTTCAGANCCCTTNCCCAGCTGTGGAAAATGAGC
HKR362577 RBd06H09 pGCAP10 NM_002733.3  
GGGGGCCTGCCCCAAGAGAGTTTCCTAAAGCGAGGAAACCAAGCCGGGCGCCTCTTGCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl