Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02049

HP ID(1) HP02049
Gene ID(2) 7378
Gene Symbol finder UPP1
Protein Name uridine phosphorylase 1
RefSeq NM_003364.2
Length of RefSeq (bp) 1796
Chromosome 7p12.3
Reference DDBJ accession
UniGene Hs.488240

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi45D12 pGCAP10 AGCTGAGTTCGCCGGCCCAGGGCAGGCGGGGCCCGAGCCTAGCGGTAACCCCCGGGCAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl