Prev. |  KEGG KO K00757 > 

RIKEN DNA Bank Human Resource - UPP1

Gene ID NCBI Gene 7378 |  KEGG hsa:7378
Gene Symbol UPP1
Protein Name uridine phosphorylase 1
Synonyms UDRPASE|UP|UPASE|UPP
Ortholog resources KEGG ortholog (KEGG orthology K00757) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX037559 IRAK093O23 pCMV-SPORT6 BC047030 NM_181597 Partial
HGY081545 IRAL003O09 pOTB7 BC007348 NM_181597 Full
HGY081716 IRAL004E20 pOTB7 BC001405 NM_181597 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100020 M01C050A20 pDONR221 MGC14-F10 BC001405 NM_181597  
HGE100068 M01C050C20 pDONR221 MGC14-F10 BC001405 NM_181597  
HGE100116 M01C050E20 pDONR221 MGC14-F10 BC001405 NM_181597  
HGE100164 M01C050G20 pDONR221 MGC14-F10 BC001405 NM_181597  
HGE100212 M01C050I20 pDONR221 MGC14-F10 BC001405 NM_181597  
HGE100260 M01C050K20 pDONR221 MGC14-F10 BC001405 NM_181597  
HGE100308 M01C050M20 pDONR221 MGC14-F10 BC001405 NM_181597  
HGE100356 M01C050O20 pDONR221 MGC14-F10 BC001405 NM_181597  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR178084 ARi45D12 pGCAP10 NM_003364.2  
AGCTGAGTTCGCCGGCCCAGGGCAGGCGGGGCCCGAGCCTAGCGGTAACCCCCGGGCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl