Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02036

HP ID(1) HP02036
Gene ID(2) 5747
Gene Symbol finder PTK2
Protein Name PTK2 protein tyrosine kinase 2
RefSeq NM_153831.2
Length of RefSeq (bp) 4453
Chromosome 8q24-qter
Reference DDBJ accession
UniGene Hs.395482

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd46B10 pGCAP10 GGCCGCCGCCGGTCCCGGACCACTGTGAGCCCGCGGCGTGAGGCGTGGGAGGAAGCGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl