Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PTK2

Gene ID (NCBI) 5747
Gene Symbol PTK2
Protein Name protein tyrosine kinase 2
Synonyms FADK|FAK|FAK1|FRNK|PPP1R71|p125FAK|pp125FAK
Databases KEGG hsa:5747 |  NCBI Gene 5747
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K05725)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008867 IRAK022C19 pCMV-SPORT6 BC015361 NM_153831 Partial/var
HGY018484 IRAK046D12 pBluescriptR BC028733 NM_153831 Partial/var
HGX020916 IRAK052E20 pCMV-SPORT6 BC035404 NM_153831 Full/var
HGY030550 IRAK076G06 pBluescriptR BC043202 NM_153831

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE010428 W01A026B04 pENTR-TOPO IRAK052E20 BC035404 NM_153831  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR378434 RBd46B10 pGCAP10 NM_153831.2  
GGCCGCCGCCGGTCCCGGACCACTGTGAGCCCGCGGCGTGAGGCGTGGGAGGAAGCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.02.22

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl