Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01977

HP ID(1) HP01977
Gene ID(2) 5036
Gene Symbol finder PA2G4
Protein Name proliferation-associated 2G4, 38kDa
RefSeq NM_006191.2
Length of RefSeq (bp) 2643
Chromosome 12q13.2
Reference DDBJ accession
UniGene Hs.524498

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe38A12 pKA1U5 GGCTCTCGCCTGCCTGCCCGCTCCCTTGCTTGCTCGCGCTTTCGCTCGCCCTCTCCTCGA
ARe84G01 pKA1U5 GGCGCTCGCAGCTTCTCGCTCTCGCCTGCCTGCCCGCTCCCTTGCTTGCTCGCGCTTTCG
ARi09H11 pGCAP10 GGCTCGCGCTTTCGCTCGCCCTCTCCTCGAGGATCGAGGGGACTCTGACCACAGCCTGTG
ARiS122H11 pGCAP10 GGCGCNCNNANCTTCTCGCTCTCGCCTGCCTGCCCGCTCCCTTGCTTGCTCGCGCTTTCG
ARiS150M10 pGCAP10 GGCGCTCGCAGCTTCTCGCTCTCGCCTGCCTGCCCGCTCCCTTGCTTGCTCGCGCTTTCG
RBb02E01 pKA1U5 TGCTTGCTCGCGCTTTCGCTCGCCCTCTCCTCGAGGATCGAGGGGACTCTGACCACAGCC
RBd02G10 pGCAP10 GGCTCGCCCTCTCCTCGAGGATCGAGGGGACTCTGACCACAGCCTGTGGCTGGGAAGGGA
RBdS156O05 pGCAP10 GGCTCTCGCCTGCCTGCCCGCTCCCTTGCTTGCTCGCGCTTTCGCTCGCCCTCTCCTCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl