Prev. | 

RIKEN DNA Bank Human Resource - PA2G4

Gene ID NCBI Gene 5036 |  KEGG hsa:5036
Gene Symbol PA2G4
Protein Name proliferation-associated 2G4
Synonyms EBP1|HG4-1|p38-2G4
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083946 IRAL009O10 pOTB7 BC001951 NM_006191 Full/var
HGY088878 IRAL022D06 pOTB7 BC007561 NM_006191 Full/var
HGY093438 IRAL033J22 pOTB7 BC032111 NM_006191 Partial
HGY103556 IRAL058O20 pOTB7 BC072007 NM_006191 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE107241 M01C068B17 pDONR221 06_08-G09 BC007561 NM_006191  
HGE107289 M01C068D17 pDONR221 06_08-G09 BC007561 NM_006191  
HGE107337 M01C068F17 pDONR221 06_08-G09 BC007561 NM_006191  
HGE107385 M01C068H17 pDONR221 06_08-G09 BC007561 NM_006191  
HGE107433 M01C068J17 pDONR221 06_08-G09 BC007561 NM_006191  
HGE107481 M01C068L17 pDONR221 06_08-G09 BC007561 NM_006191  
HGE107529 M01C068N17 pDONR221 06_08-G09 BC007561 NM_006191  
HGE107577 M01C068P17 pDONR221 06_08-G09 BC007561 NM_006191  
HGE124814 M01C112A14 pDONR221 06-2_04-F07 BC007561 NM_006191  
HGE124862 M01C112C14 pDONR221 06-2_04-F07 BC007561 NM_006191  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006610 W01A016I18 pENTR-TOPO IRAL009O10 BC001951 NM_006191  
HGE006612 W01A016I20 pENTR-TOPO IRAL009O10 BC001951 NM_006191  
HGE006606 W01A016I14 pENTR-TOPO IRAL022D06 BC007561 NM_006191  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR055212 ARe38A12 pKA1U5 NM_006191.2  
GGCTCTCGCCTGCCTGCCCGCTCCCTTGCTTGCTCGCGCTTTCGCTCGCCCTCTCCTCGA
HKR073745 ARe84G01 pKA1U5 NM_006191.2  
GGCGCTCGCAGCTTCTCGCTCTCGCCTGCCTGCCCGCTCCCTTGCTTGCTCGCGCTTTCG
HKR163779 ARi09H11 pGCAP10 NM_006191.2  
GGCTCGCGCTTTCGCTCGCCCTCTCCTCGAGGATCGAGGGGACTCTGACCACAGCCTGTG
HKR248979 ARiS122H11 pGCAP10 NM_006191.2  
GGCGCNCNNANCTTCTCGCTCTCGCCTGCCTGCCCGCTCCCTTGCTTGCTCGCGCTTTCG
HKR260298 ARiS150M10 pGCAP10 NM_006191.2  
GGCGCTCGCAGCTTCTCGCTCTCGCCTGCCTGCCCGCTCCCTTGCTTGCTCGCGCTTTCG
HKR320897 RBb02E01 pKA1U5 NM_006191.2  
TGCTTGCTCGCGCTTTCGCTCGCCCTCTCCTCGAGGATCGAGGGGACTCTGACCACAGCC
HKR360954 RBd02G10 pGCAP10 NM_006191.2  
GGCTCGCCCTCTCCTCGAGGATCGAGGGGACTCTGACCACAGCCTGTGGCTGGGAAGGGA
HKR462741 RBdS156O05 pGCAP10 NM_006191.2  
GGCTCTCGCCTGCCTGCCCGCTCCCTTGCTTGCTCGCGCTTTCGCTCGCCCTCTCCTCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl