Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01932

HP ID(1) HP01932
Gene ID(2) 9491
Gene Symbol finder PSMF1
Protein Name proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
RefSeq NM_006814.3
Length of RefSeq (bp) 3695
Chromosome 20p13
Reference DDBJ accession
UniGene Hs.471917

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe28C04 pKA1U5 GGTCCCCGGGCGTCTCCATTTTGGTCTCAGGTGTGGACTCGGCAAGAACCAGCGCAAGAG
ARi16E10 pGCAP10 GGCTTCCCCGCCCCGCCCCGTCCCCGGGCGTCTCCATTTTGGTCTCAGGTGTGGACTCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl