Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PSMF1

Gene ID (NCBI) 9491
Gene Symbol PSMF1
Protein Name proteasome inhibitor subunit 1
Synonyms PI31
Databases KEGG hsa:9491 |  NCBI Gene 9491
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06700)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051252 ARe28C04 pKA1U5 NM_006814.3  
GGTCCCCGGGCGTCTCCATTTTGGTCTCAGGTGTGGACTCGGCAAGAACCAGCGCAAGAG
HKR166506 ARi16E10 pGCAP10 NM_006814.3  
GGCTTCCCCGCCCCGCCCCGTCCCCGGGCGTCTCCATTTTGGTCTCAGGTGTGGACTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl