Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01928

HP ID(1) HP01928
Gene ID(2) 51186
Gene Symbol finder WBP5
Protein Name WW domain binding protein 5
RefSeq NM_001006612.1
Length of RefSeq (bp) 1099
Chromosome Xq22.1-q22.2
Reference DDBJ accession
UniGene Hs.533287

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi51G06 pGCAP10 GGTCCTTGTTCCCGTCTGGATACCAGCTTCCTTCAGCAGCGCAGGCGGTGGTCCCTGAGG
ARi66B04 pGCAP10 GAATCTGGTCCTTGTTCCCGTCTGGATACCAGCTTCCTTCAGCAGCGCAGGCGGTGGTCC
ARiS020M17 pGCAP10 GGTCCTTNNTCCCGTCTGGATACCAGCTTCCTTCAGCAGCGCAGGCGGTGGTCCCTGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl