Prev. | 

RIKEN DNA Bank Human Resource - TCEAL9

Gene ID NCBI Gene 51186 |  KEGG hsa:51186
Gene Symbol TCEAL9
Protein Name transcription elongation factor A like 9
Synonyms WBP5|WEX6
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY090477 IRAL026D05 pOTB7 BC023544 NM_016303 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR180550 ARi51G06 pGCAP10 NM_001006612.1  
GGTCCTTGTTCCCGTCTGGATACCAGCTTCCTTCAGCAGCGCAGGCGGTGGTCCCTGAGG
HKR186428 ARi66B04 pGCAP10 NM_001006612.1  
GAATCTGGTCCTTGTTCCCGTCTGGATACCAGCTTCCTTCAGCAGCGCAGGCGGTGGTCC
HKR208305 ARiS020M17 pGCAP10 NM_001006612.1  
GGTCCTTNNTCCCGTCTGGATACCAGCTTCCTTCAGCAGCGCAGGCGGTGGTCCCTGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl