Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01912

HP ID(1) HP01912
Gene ID(2) 5880
Gene Symbol finder RAC2
Protein Name ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
RefSeq NM_002872.3
Length of RefSeq (bp) 1516
Chromosome 22q13.1
Reference DDBJ accession
UniGene Hs.517601

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe77C08 pKA1U5 GCTGCCCCACCACCGCTGCTCCTCAGCAGGCGCCTCTCAGCCTCCACACCCCTTGCGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl