Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01879

HP ID(1) HP01879
Gene ID(2) 5709
Gene Symbol finder PSMD3
Protein Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
RefSeq NM_002809.2
Length of RefSeq (bp) 2174
Chromosome 17q12-q21.1
Reference DDBJ accession
UniGene Hs.12970

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe19E04 pKA1U5 GAGAAGGCCCAGCGCCGGGAAGGGGTTTGCAGCTGCTCCGTCATCGTGCGGCCCGACGCT
ARi48A10 pGCAP10 GAGAAGGCCCAGCGCCGGGAAGGGGTTTGCAGCTGCTCCGTCATCGTGCGGCCCGACGCT
ARiS008P12 pGCAP10 GGCAGCTGCTCCGTCATCGTGCGGCCCGACGCTATCTCGCGCTCGTGTGCAGGCCCGGCT
RBd13C12 pGCAP10 TGATCTCGCGCTCGTGTGCAGGCCCGGCTCGGCTCCTGGTCCCCGGTGCGAGGGTTAACG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl